WormMine: Gene WBGene00040409

• WormBase Gene ID: WBGene00040409
• Gene Name: Cbr-rpn-7
• Sequence Name: CBG21707
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Winged helix DNA-binding domain superfamily; PCI domain; 26S Proteasome non-ATPase regulatory subunit 6; Proteasome component (PCI) domain; 26S proteasome subunit RPN7; and 26S proteasome regulatory subunit Rpn7/COP9 signalosome complex subunit 1. Is an ortholog of C. elegans rpn-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21707.1	CBG21707.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21707	CBG21707		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1055982
• Remark: Cbr-rpn-7, CGAACTGATGACATACGAAAATCTTATTCTGTACACTGTGATCACAACTACGTTCGCATT, WBGene00040409
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term