WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00074485 Gene Name  CRE10751
Sequence Name  ? CRE10751 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: PUB domain and PUB-like domain superfamily. Is an ortholog of C. elegans ubxn-6. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE10751a.1 CRE10751a.1   [unknown]
Transcript:CRE10751b.1 CRE10751b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE10751b CRE10751b   [unknown]
CDS:CRE10751a CRE10751a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE10751, CGGCATTGAGCGCTGACTTCTACAATTTGTCGGCTGCTGAGATCAAGGCAGAGCAAAAGA, WBGene00074485   Expr1092317 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term