WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024823 Gene Name  CBG01609
Sequence Name  ? CBG01609 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans F56A11.4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01609a.2 CBG01609a.2   [unknown]
Transcript:CBG01609a.1 CBG01609a.1   [unknown]
Transcript:CBG01609c.1 CBG01609c.1   [unknown]
Transcript:CBG01609b.1 CBG01609b.1   [unknown]
Transcript:CBG01609b.2 CBG01609b.2   [unknown]
Transcript:CBG01609d.1 CBG01609d.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01609a CBG01609a   [unknown]
CDS:CBG01609b CBG01609b   [unknown]
CDS:CBG01609c CBG01609c   [unknown]
CDS:CBG01609d CBG01609d   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG01609, TCCATTGTAACCGAGACATTCGAACACAGATACGAGATTTTGCTAGAAGTTGTTTTATTG, WBGene00024823   Expr1054609 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term