WormMine: Gene WBGene00038818

• WormBase Gene ID: WBGene00038818
• Gene Name: CBG19637
• Sequence Name: CBG19637
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Enoyl-CoA hydratase/isomerase; ClpP/crotonase-like domain superfamily; and Enoyl-CoA hydratase, C-terminal. Is an ortholog of C. elegans Y25C1A.13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19637.1	CBG19637.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19637	CBG19637		[unknown]

0 RNAi Result

3 Allele

• WBVar00027262
• WBVar00027267
• WBVar00027257

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068522
• Remark: CBG19637, TTGATGAATAGTGCATTGGCGGCGATGAACAAGAAGAAGGCCACTTATGAGGATGTTTGA, WBGene00038818
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term