WormMine: Gene WBGene00038913

• WormBase Gene ID: WBGene00038913
• Gene Name: Cbr-sol-2
• Sequence Name: CBG19743
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: CUB domain and Spermadhesin, CUB domain superfamily. Is an ortholog of C. elegans sol-2. In C. elegans, sol-2 is involved in several processes, including hyperosmotic response; positive regulation of glutamatergic synaptic transmission; and thigmotaxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19743.1	CBG19743.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19743	CBG19743		[unknown]

0 RNAi Result

3 Allele

• WBVar00027692
• WBVar00027697
• WBVar00027687

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063542
• Remark: CBG19743, GTCAAGTGCAAATCGGATTGTGGTCAGATTGGTGACACAGGAGGGACCAGCTAGTTCAAT, WBGene00038913
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term