WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038304 Gene Name  Cbr-spe-39
Sequence Name  ? CBG19018 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Vps16, C-terminal domain superfamily and Spermatogenesis-defective protein 39. Is an ortholog of C. elegans spe-39. In C. elegans, spe-39 is involved in germ cell development; vacuolar protein processing; and vacuolar transport. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG19018.1 CBG19018.1   [unknown]
Transcript:CBG19018.2 CBG19018.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG19018 CBG19018   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00026207
WBVar00026212

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-spe-39, GGTGATCGAGTGTATGACACAAAAAGGAGACAGAGTGTCGTTGGCTTCTTATGCGAAATC, WBGene00038304   Expr1058258 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term