WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00071697 Gene Name  CRE09840
Sequence Name  ? CRE09840 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; DNA2/NAM7 helicase-like, C-terminal; and AAA domain. Is an ortholog of C. elegans K08D10.5 and R03D7.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE09840.1 CRE09840.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE09840 CRE09840   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE09888, AACTCAAGGCCGTGAATACGATCTTGTCGTTCTGCTCACCACAAGAAGCCAAGAATTTTC, WBGene00071700   Expr1111422 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE09840, CGAGCAAGCGAGAAAACTCTCGAGCCACAAATACTGGAAAGTGAAGACCTGTTGCCGTCT, WBGene00071697   Expr1109276 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term