WormMine: Gene WBGene00042612

• WormBase Gene ID: WBGene00042612
• Gene Name: Cbr-tmed-4
• Sequence Name: CBG24517
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Transmembrane emp24 domain-containing protein; emp24/gp25L/p24 family/GOLD; and GOLD domain. Is an ortholog of C. elegans tmed-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24517.1	CBG24517.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24517	CBG24517		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062162
• Remark: CBG24517, GAGCTGCAGCTGCGTATCCGTCAACTCCTCGACCAAGTGGATCAAATCACAAAAGAGCAG, WBGene00042612
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term