WormMine: Gene WBGene00042613

• WormBase Gene ID: WBGene00042613
• Gene Name: Cbr-gly-4
• Sequence Name: CBG24518
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Nucleotide-diphospho-sugar transferases; Glycosyltransferase 2-like; Glycosyl transferase family 2; Ricin B-like lectins; Ricin-type beta-trefoil lectin domain; and Ricin B, lectin domain. Is an ortholog of C. elegans gly-4. In C. elegans, gly-4 is involved in protein O-linked glycosylation via threonine.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24518.1	CBG24518.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24518	CBG24518		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066669
• Remark: Cbr-gly-4, AACCCGAAGGCAGTGGTCGCGCCGATTATCGATGTGATAAACGTTGATAATTTCAATTAT, WBGene00042613
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term