WormMine: Gene WBGene00121309

• WormBase Gene ID: WBGene00121309
• Gene Name: Cjp-pxmp-4
• Sequence Name: CJA02105
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Tim17/Tim22/Tim23/Pmp24 family and Peroxisomal membrane protein 4. Is an ortholog of C. elegans pxmp-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02105.1	CJA02105.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02105	CJA02105		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074011
• Remark: CJA02105, AATCCATGACGTACTTGTACCATGACTCAAACTTTTGGACCGACATTAAAACTTTTCTAC, WBGene00121309
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term