WormMine: Gene WBGene00042943

• WormBase Gene ID: WBGene00042943
• Gene Name: CBG24954
• Sequence Name: CBG24954
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; Ankyrin repeats (3 copies); and Ankyrin repeat. Is an ortholog of C. elegans mel-11. In C. elegans, mel-11 is involved in embryo development and embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24954.1	CBG24954.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24954	CBG24954		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061472
• Remark: CBG24954, GCAGCGGATCAATGGTACCACCGGCGTCTGTGCTACAGGAGAAAAATCAGAGAATATCGC, WBGene00042943
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term