WormMine: Gene WBGene00042077

• WormBase Gene ID: WBGene00042077
• Gene Name: CBG23818
• Sequence Name: CBG23818
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Intron-binding protein aquarius, N-terminal and Intron-binding protein aquarius N-terminus. Is an ortholog of C. elegans emb-4 and ztf-20.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23818.1	CBG23818.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23818	CBG23818		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055563
• Remark: CBG23818, AGTATTTATGGCCTAATTATCAGGCCCAATCGGCTTCCAAAGCCTATAATCTGTCGATTG, WBGene00042077
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term