WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042431 Gene Name  Cbr-nud-1
Sequence Name  ? CBG24281 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: N-terminal conserved domain of Nudc.; CS domain; NudC family; HSP20-like chaperone; and NudC N-terminal domain. Is an ortholog of C. elegans nud-1. In C. elegans, nud-1 is involved in several processes, including GABAergic synaptic transmission; chaperone-mediated protein folding; and establishment of organelle localization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG24281.1 CBG24281.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG24281 CBG24281   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-nud-1, GGGACTGCCGACGTCAGATGAGAAGAAGAAGCAGGATATGTTGCAGCAGTTCATGAAGCA, WBGene00042431   Expr1054236 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term