WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00120789 Gene Name  Cjp-sorf-2
Sequence Name  ? CJA01585 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: BEACH domain; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; WD40-repeat-containing domain superfamily; BEACH domain superfamily; Beige/BEACH domain; and WD domain, G-beta repeat. Is an ortholog of C. elegans sorf-2. In C. elegans, sorf-2 is involved in organelle fusion and positive regulation of early endosome to late endosome transport. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA01585a.1 CJA01585a.1   [unknown]
Transcript:CJA01585b.1 CJA01585b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA01585a CJA01585a   [unknown]
CDS:CJA01585b CJA01585b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA01585, TGTCCGACCATCAGCTTATGAACTATTTGGAAGTGAGAATTATATGCACAGTGCTTCCAA, WBGene00120789   Expr1083277 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24333, TCAGGAGTTTATAATCCAAAAAGTGATCTACCGAGTTCTCACCATCATTGTGGATGACAG, WBGene00179905   Expr1082773 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term