WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038448 Gene Name  CBG19185
Sequence Name  ? CBG19185 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Alpha crystallin/Small heat shock protein, animal type; Alpha crystallin/Hsp20 domain; Hsp20/alpha crystallin family; and HSP20-like chaperone. Is an ortholog of C. elegans hsp-16.41 and hsp-16.48. In C. elegans, hsp-16.41 is involved in defense response to Gram-negative bacterium and response to heat. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG19185.1 CBG19185.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG19185 CBG19185   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG
Virus infection: Santeuil infected at L3 larva stage for 12 hours. Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264. edgeR, FDR < 0.05. WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG19185, ACGATGGAAAGCTGCAGATCGAGGCACCAAAAAAGGCCAATACTTCTCGCTCCATTCCTA, WBGene00038448   Expr1062192 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term