WormMine: Gene WBGene00041475

• WormBase Gene ID: WBGene00041475
• Gene Name: Cbr-gmn-1
• Sequence Name: CBG23049
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans gmn-1. In C. elegans, gmn-1 is involved in negative regulation of DNA replication and negative regulation of cell cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23049.1	CBG23049.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23049	CBG23049		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054746
• Remark: Cbr-gmn-1, TTCAACCAAAAATCGTCGAATCCGATCTCACTGCGGCCACGCCCACAATCAATTATCTGC, WBGene00041475
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term