WormMine: Gene WBGene00041452

• WormBase Gene ID: WBGene00041452
• Gene Name: Cbr-lury-1
• Sequence Name: CBG23020
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans lury-1. In C. elegans, lury-1 is involved in several processes, including determination of adult lifespan; negative regulation of feeding behavior; and positive regulation of egg-laying behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23020.1	CBG23020.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23020	CBG23020		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052246
• Remark: CBG23020, AAGAAACCTCCGAAGTCGTCTGCCAACTCATCGATGGAAAGTACATCTGTCTTCCGGTCG, WBGene00041452
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term