WormMine: Gene WBGene00041786

• WormBase Gene ID: WBGene00041786
• Gene Name: Cbr-ssp-34
• Sequence Name: CBG23425
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Major sperm protein (MSP) domain; Immunoglobulin-like fold; MSP (Major sperm protein) domain; and PapD-like superfamily. Is an ortholog of C. elegans ssp-34.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23425.1	CBG23425.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23425	CBG23425		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054403
• Remark: CBG23425, CCGATGCAACGGCTCCATTCAAGGCTGGAGCACAACAAGGAGAAATCATTGTGAAGATCG, WBGene00041786
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term