WormMine: Gene WBGene00041678

• WormBase Gene ID: WBGene00041678
• Gene Name: CBG23299
• Sequence Name: CBG23299
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: DAN; Cystine-knot cytokine; DAN domain; and Cystine knot, C-terminal. Is an ortholog of C. elegans F35B12.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23299b.1	CBG23299b.1		[unknown]
Transcript:CBG23299a.3	CBG23299a.3		[unknown]
Transcript:CBG23299a.2	CBG23299a.2		[unknown]
Transcript:CBG23299a.1	CBG23299a.1		[unknown]
Transcript:CBG23299c.1	CBG23299c.1		[unknown]
Transcript:CBG23299c.2	CBG23299c.2		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23299b	CBG23299b		[unknown]
CDS:CBG23299a	CBG23299a		[unknown]
CDS:CBG23299c	CBG23299c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057862
• Remark: CBG23299, TACGTCGATATAACCTTAGACTGTCCTGGCAAATCTCCGCCAACTACAACCAAAACGATT, WBGene00041678
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term