WormMine: Gene WBGene00041037

• WormBase Gene ID: WBGene00041037
• Gene Name: Cbr-mks-1
• Sequence Name: CBG22495
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ciliary basal body-associated, B9 protein and B9-type C2 domain. Is an ortholog of C. elegans mks-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22495.1	CBG22495.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22495	CBG22495		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054069
• Remark: Cbr-mks-1, CCATCTGGAAGATCCCAAAGATTTTCAGCAGAAGAATCTGGAGAAATCATAAATTTCGGG, WBGene00041037
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term