WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00120838 Gene Name  Cjp-pqn-65
Sequence Name  ? CJA01634 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Protein of unknown function (DUF1280) and Protein of unknown function DUF1280. Is an ortholog of C. elegans pqn-65. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA01634b.1 CJA01634b.1   [unknown]
Transcript:CJA01634a.1 CJA01634a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA01634a CJA01634a   [unknown]
CDS:CJA01634b CJA01634b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-pqn-65, CAGATGATGATTGAAGAGCCGTGCAAGCCAGAAATATGTGTCGACGATGTTCTTGAGAAT, WBGene00120838   Expr1070612 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA28627, ACTTGTGGAATGGATTCTAGAGGAGTTATCAGCATTTGTTCAATTGCTTTATGATGACTA, WBGene00184201   Expr1090026 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term