WormMine: Gene WBGene00031553

• WormBase Gene ID: WBGene00031553
• Gene Name: CBG10074
• Sequence Name: CBG10074
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Hyccin. Is an ortholog of C. elegans D1069.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10074b.1	CBG10074b.1		[unknown]
Transcript:CBG10074c.1	CBG10074c.1		[unknown]
Transcript:CBG10074a.1	CBG10074a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10074b	CBG10074b		[unknown]
CDS:CBG10074c	CBG10074c		[unknown]
CDS:CBG10074a	CBG10074a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060345
• Remark: CBG10074, AGGTGGACTTCAACATAAAATGCATCGTAGGAAGAAAAGTGTTGAACCCGAAGAGAATGA, WBGene00031553
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term