WormMine: Gene WBGene00120881

• WormBase Gene ID: WBGene00120881
• Gene Name: Cjp-srm-2
• Sequence Name: CJA01677
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class r (Str) and Serpentine type 7TM GPCR chemoreceptor Str. Is an ortholog of C. elegans srm-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01677c.1	CJA01677c.1		[unknown]
Transcript:CJA01677a.1	CJA01677a.1		[unknown]
Transcript:CJA01677b.1	CJA01677b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01677a	CJA01677a		[unknown]
CDS:CJA01677b	CJA01677b		[unknown]
CDS:CJA01677c	CJA01677c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084866
• Remark: Cjp-srm-2, TGCCAATGTTCGATATGGAGAACAACTTTTTGTCGGCCAATTTACCGTATCTTTTTTCGT, WBGene00120881
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term