WormMine: Gene WBGene00052681

• WormBase Gene ID: WBGene00052681
• Gene Name: CRE27188
• Sequence Name: CRE27188
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Caenorhabditis protein of unknown function, DUF267 and Protein of unknown function DUF267, Caenorhabditis species. Is an ortholog of C. elegans srr-10; srr-8; and srr-9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27188.1	CRE27188.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27188	CRE27188		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106605
• Remark: CRE27188, GATTCTCATGTTTAATTTTGCTGCAGTTATCGTCTACAATCTCTGTATCCTATTCCCAAC, WBGene00052681
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term