1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00002062 | ife-4 | C05D9.5 | Caenorhabditis elegans |
| WormBase ID | WBStrain00024078 | CGC Received | 2003-10-24 |
| Genotype | ife-4(ok320) X. | Laboratory | CGC |
| Made By | WBPerson1666 | Mutagen | UV+TMP |
| Name | KX17 | Outcrossed | x10 |
| Remark | C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4). | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00002062 | ife-4 | C05D9.5 | Caenorhabditis elegans |
