WormMine: Gene WBGene00038648

• WormBase Gene ID: WBGene00038648
• Gene Name: Cbr-rmd-2
• Sequence Name: CBG19424
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Tetratricopeptide repeat and Tetratricopeptide-like helical domain superfamily. Is an ortholog of C. elegans rmd-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19424a.1	CBG19424a.1		[unknown]
Transcript:CBG19424c.1	CBG19424c.1		[unknown]
Transcript:CBG19424b.1	CBG19424b.1		[unknown]
Transcript:CBG19424b.2	CBG19424b.2		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19424c	CBG19424c		[unknown]
CDS:CBG19424b	CBG19424b		[unknown]
CDS:CBG19424a	CBG19424a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058992
• Remark: Cbr-rmd-2, ACCAATGACAACGAGAAGGAACTTCTCGCTGAAGCCAAGACTCTCTGCTCCAAATGCTAA, WBGene00038648
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term