WormMine: Gene WBGene00214379

• WormBase Gene ID: WBGene00214379
• Gene Name: CJA38532
• Sequence Name: CJA38532
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat and Leucine-rich repeat domain superfamily. Is an ortholog of C. elegans mog-2. In C. elegans, mog-2 is involved in feminization of hermaphroditic germ-line; germline cell cycle switching, mitotic to meiotic cell cycle; and mRNA 3'-splice site recognition.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA38532a.1	CJA38532a.1		[unknown]
Transcript:CJA38532b.1	CJA38532b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA38532b	CJA38532b		[unknown]
CDS:CJA38532a	CJA38532a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077361
• Remark: CJA10279, GAAAATTGGACAATTTTCCGACGTTCACACGGCTCACCACTCTGTATCTGCACAATAATC, WBGene00129483
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term