WormMine: Gene WBGene00038680

• WormBase Gene ID: WBGene00038680
• Gene Name: CBG19471
• Sequence Name: CBG19471
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: RPEL repeat. Is an ortholog of C. elegans F26H9.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19471b.1	CBG19471b.1		[unknown]
Transcript:CBG19471a.1	CBG19471a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19471b	CBG19471b		[unknown]
CDS:CBG19471a	CBG19471a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055089
• Remark: CBG19471, GACAAGGCCATGATTCGGAAGGAGTTGAATGATTTCAAGGCGACCGAGATGGACGTGCAT, WBGene00038680
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term