WormMine: Gene WBGene00214420

• WormBase Gene ID: WBGene00214420
• Gene Name: CJA38573
• Sequence Name: CJA38573
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: GRIM-19 and GRIM-19 protein. Is an ortholog of C. elegans C34B2.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA38573a.1	CJA38573a.1		[unknown]
Transcript:CJA38573b.1	CJA38573b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA38573b	CJA38573b		[unknown]
CDS:CJA38573a	CJA38573a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088360
• Remark: CJA00092, CTCAAACTTTTGGCCAAGAATCGCGCTCTGGAAGAGGAAATTATGAAGGATGTTCCAGGG, WBGene00119296
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term