WormMine: Gene WBGene00137557

• WormBase Gene ID: WBGene00137557
• Gene Name: Cjp-pat-9
• Sequence Name: CJA18352
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans pat-9. In C. elegans, pat-9 is involved in regulation of striated muscle cell differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18352a.1	CJA18352a.1		[unknown]
Transcript:CJA18352b.1	CJA18352b.1		[unknown]
Transcript:CJA18352c.1	CJA18352c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18352b	CJA18352b		[unknown]
CDS:CJA18352a	CJA18352a		[unknown]
CDS:CJA18352c	CJA18352c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075901
• Remark: Cjp-ztf-19, CAAGAGTATCAGCCCTTTGATTACTCCATGGTCAATCAACCGTACCAGATGCCGGATCAA, WBGene00137557
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term