WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132556 Gene Name  CJA13352
Sequence Name  ? CJA13352 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: Cadherin-like. Is an ortholog of C. elegans C48E7.6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13352a.1 CJA13352a.1   [unknown]
Transcript:CJA13352b.1 CJA13352b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13352a CJA13352a   [unknown]
CDS:CJA13352b CJA13352b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA13352, ACGGACACACCACCACCAATGCGTCTGTTTGATCAAGTTGCTCAGACACAACCCACTAAT, WBGene00132556   Expr1087853 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA21667, CATTTGGGACATCACGGAGAGTTTTTTATTCGGTTAGTTTTGAGTTGTTTCTCATTTTAA, WBGene00177239   Expr1086405 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA21116, CGATCACTGAAAATGAAACAACCGCGTTTTCTCTGAAGTGCATTTCGCACATTTCGCTGC, WBGene00176688   Expr1080866 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term