WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031745 Gene Name  Cbr-rgs-4
Sequence Name  ? CBG10338 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: RGS domain; Regulator of G protein signaling domain; and RGS domain superfamily. Is an ortholog of C. elegans rgs-4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG10338a.1 CBG10338a.1   [unknown]
Transcript:CBG10338b.1 CBG10338b.1   [unknown]
Transcript:CBG10338c.1 CBG10338c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG10338c CBG10338c   [unknown]
CDS:CBG10338a CBG10338a   [unknown]
CDS:CBG10338b CBG10338b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-rgs-4, TTCGTTCACACCAGCGCCTACAAGGACGTCGCCAAGAAGTTGTCCCTTCCGCAGACATTT, WBGene00031745   Expr1061325 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG10334, AGTTGTCCCGAGTCAAAATTTCCATGCGTGATCGCAAACGGAAGGCATCGAAATCCAGTT, WBGene00031742   Expr1062775 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term