WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00125014 Gene Name  Cjp-rin-1
Sequence Name  ? CJA05810 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: VPS9 domain superfamily; VPS9 domain; and Vacuolar sorting protein 9 (VPS9) domain. Is an ortholog of C. elegans rin-1. In C. elegans, rin-1 is involved in dorsal/ventral axon guidance and neuron migration. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA05810.1 CJA05810.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA05810 CJA05810   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA17453, GCAAAGAAGCACTTGAGACGGCTCTAATCAACGCCGACAAACGACGTCATCCATCGGATT, WBGene00136659   Expr1086036 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-tag-333, TCACATGTTTGCTTATAAAAGACACGAGGCAAAGATTGCATGGCCACGTGCCGCCATCTC, WBGene00125014   Expr1089722 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term