WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135838 Gene Name  CJA16635
Sequence Name  ? CJA16635 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Domain of unknown function DUF3338; Band 4.1 domain; FERM C-terminal PH-like domain; FERM, C-terminal PH-like domain; Cytohesin Ubiquitin Protein Inducing Domain; and Ubiquitin-like domain superfamily. Is an ortholog of C. elegans F07C6.4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16635.1 CJA16635.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16635 CJA16635   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA20137, CGATTGGAAACAAAGGGATCTACGTGTACCGAAGAAGTCGTCATCAGAATCTGATTACTC, WBGene00175708   Expr1086362 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA16635, TACAAGCAGCAACAACATCAGCACCCGTCACGACCTGCGCCGTCTCAACATCAACAGCAT, WBGene00135838   Expr1071975 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA08370, GGACAGCTCTGTGATTCTGTACGACCTGGTCGCATCAACTTCAAATCCGAAGGGCATATT, WBGene00127575   Expr1092149 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term