WormMine: Gene WBGene00026809

• WormBase Gene ID: WBGene00026809
• Gene Name: Cbr-vps-51
• Sequence Name: CBG04063
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Cullin repeat-like-containing domain superfamily; Vps51/Vps67; and Vacuolar protein sorting-associated protein 51. Is an ortholog of C. elegans vps-51. In C. elegans, vps-51 is involved in negative regulation of dense core granule transport; positive regulation of dense core granule transport; and positive regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04063.1	CBG04063.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04063	CBG04063		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051712
• Remark: Cbr-vps-51, CGTAAATTCGATGGTTGATCAAGCACTATCCTCTGCACTCAAAAGATGTCAGGATCCAGT, WBGene00026809
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term