WormMine: Gene WBGene00031908

• WormBase Gene ID: WBGene00031908
• Gene Name: Cbr-fln-1
• Sequence Name: CBG10542
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin E-set; Calponin homology (CH) domain; Filamin/ABP280 repeat; Calponin homology domain; Immunoglobulin-like fold; Filamin/ABP280 repeat-like; and CH domain superfamily. Is an ortholog of C. elegans fln-1. In C. elegans, fln-1 is involved in several processes, including axon development; semaphorin-plexin signaling pathway; and uterus morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10542a.1	CBG10542a.1		[unknown]
Transcript:CBG10542b.1	CBG10542b.1		[unknown]
Transcript:CBG10542c.1	CBG10542c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10542c	CBG10542c		[unknown]
CDS:CBG10542b	CBG10542b		[unknown]
CDS:CBG10542a	CBG10542a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

2 Expression Patterns

• Primary Identifier: Expr1061712
• Remark: CBG10541, CATCGAAAGCCACGCTGGATGCGTATGAGCTGGAGAAGGGATACAAAGTGAGATACACTC, WBGene00031907
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1060931
• Remark: CBG10542, AAGGAGCAAAACTGAAAGTCCCTATTCGTCGATTTCTAGTGGATCATCGAGTACACCCAA, WBGene00031908
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term