WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032532 Gene Name  Cbr-sao-1
Sequence Name  ? CBG11416 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: GYF domain and GYF-like domain superfamily. Is an ortholog of C. elegans sao-1. In C. elegans, sao-1 is involved in negative regulation of Notch signaling pathway and regulation of protein deneddylation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11416e.1 CBG11416e.1   [unknown]
Transcript:CBG11416d.1 CBG11416d.1   [unknown]
Transcript:CBG11416a.1 CBG11416a.1   [unknown]
Transcript:CBG11416c.1 CBG11416c.1   [unknown]
Transcript:CBG11416b.1 CBG11416b.1   [unknown]
 

Other

5 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11416e CBG11416e   [unknown]
CDS:CBG11416a CBG11416a   [unknown]
CDS:CBG11416b CBG11416b   [unknown]
CDS:CBG11416c CBG11416c   [unknown]
CDS:CBG11416d CBG11416d   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG11416, GTTCGTGCAAATGCCGTTCCTCCATCAAATGAACCAAAACGGTCCACCTCTGATGCACTC, WBGene00032532   Expr1056409 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term