WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00178617 Gene Name  CJA23045
Sequence Name  ? CJA23045 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Herpesvirus Glycoprotein B ectodomain; Aspartic peptidase domain superfamily; Retrotransposon gag protein; and Retrotransposon gag domain. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA23045a.1 CJA23045a.1   [unknown]
Transcript:CJA23045c.1 CJA23045c.1   [unknown]
Transcript:CJA23045b.1 CJA23045b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA23045a CJA23045a   [unknown]
CDS:CJA23045b CJA23045b   [unknown]
CDS:CJA23045c CJA23045c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA13331, GATATCATGCTCATTTCCGTCTGAACTCCAACTACAGCGCCATCAAATCCACATTCACAT, WBGene00132535   Expr1083738 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA25196, TTTTAATCCAACAGCTAGCACGCTCCGAGTTAAGACCAAGAAACCGATCGCTATTGCCTC, WBGene00180768   Expr1086335 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24352, CTACACCACACTGGAAGAAGAGACGGGAGTCTCAACGGGAGCTGACAAAGAGAATGAAAG, WBGene00179924   Expr1072411 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term