WormMine: Gene WBGene00127815

• WormBase Gene ID: WBGene00127815
• Gene Name: Cjp-dpy-11
• Sequence Name: CJA08611
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Thioredoxin; Thioredoxin domain; and Thioredoxin-like superfamily. Is an ortholog of C. elegans dpy-11. In C. elegans, dpy-11 is involved in several processes, including cuticle development involved in collagen and cuticulin-based cuticle molting cycle; post-embryonic body morphogenesis; and protein folding.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08611.1	CJA08611.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08611	CJA08611		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087060
• Remark: Cjp-dpy-11, CGACTGGACCGAGAAAGAACCAGCAGCAGGCGAAGAAGGCTGAGAAGAAGACCGAGAAGA, WBGene00127815
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term