WormMine: Gene WBGene00126150

• WormBase Gene ID: WBGene00126150
• Gene Name: CJA06946
• Sequence Name: CJA06946
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: GOLD domain; Golgi-dynamics membrane-trafficking; and GOLD domain superfamily. Is an ortholog of C. elegans Y41E3.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06946c.1	CJA06946c.1		[unknown]
Transcript:CJA06946a.1	CJA06946a.1		[unknown]
Transcript:CJA06946b.1	CJA06946b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06946c	CJA06946c		[unknown]
CDS:CJA06946a	CJA06946a		[unknown]
CDS:CJA06946b	CJA06946b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076874
• Remark: CJA06946, GACAATTCTTACTCGCTGTGGAGATCAAAGACCCTCTACTATCGTGTTTACTATAGCAAA, WBGene00126150
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term