WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00119791 Gene Name  CJA00587
Sequence Name  ? CJA00587 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; Aspartic peptidase domain superfamily; and Ribonuclease H-like superfamily. Is an ortholog of C. elegans sosi-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00587a.1 CJA00587a.1   [unknown]
Transcript:CJA00587c.1 CJA00587c.1   [unknown]
Transcript:CJA00587b.1 CJA00587b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00587a CJA00587a   [unknown]
CDS:CJA00587b CJA00587b   [unknown]
CDS:CJA00587c CJA00587c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA10894, AACTTATGGAGACCGCGCTCGAAATGTTACAACCAATTGCAGAGGCAGTGAAGCTTGTTC, WBGene00130098   Expr1085299 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA27899, AGACCGCGCTCGAAATGTTACAACCAATTGCAGAGGCAGTGAAGCTTGTTCAGGTGAACA, WBGene00183472   Expr1071895 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA00587, TTGAATGTAGTACATCGATGCCCTAACCTAATTACACACATCATTTCGAGGATGTTCTAT, WBGene00119791   Expr1088349 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term