WormMine: Gene WBGene00034812

• WormBase Gene ID: WBGene00034812
• Gene Name: CBG14248
• Sequence Name: CBG14248
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Phorbol esters/diacylglycerol binding domain (C1 domain); C2 domain; Protein kinase C-like, phorbol ester/diacylglycerol-binding domain; C2 domain superfamily; and C2 domain-containing protein 2-like. Is an ortholog of C. elegans R11G1.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14248.1	CBG14248.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14248	CBG14248		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068604
• Remark: CBG14248, GACTGGGCACACTACCTTAGTCATTACCAATTAGAAGAATTCATCTCCAGCGAAGGACTA, WBGene00034812
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term