WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024090 Gene Name  Cbr-ctns-1
Sequence Name  ? CBG00747 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: PQ-loop repeat; Lysosomal cystine transporter; and PQ loop repeat. Is an ortholog of C. elegans ctns-1. In C. elegans, ctns-1 is involved in L-cystine transport; lysosome organization; and phagocytosis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00747b.1 CBG00747b.1   [unknown]
Transcript:CBG00747b.2 CBG00747b.2   [unknown]
Transcript:CBG00747a.1 CBG00747a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00747a CBG00747a   [unknown]
CDS:CBG00747b CBG00747b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ctns-1, GGACATCCTTCAAATGGTCCTTCAAGCGATCAATGTCAACGATTGGTCGGCGTTCTACGC, WBGene00024090   Expr1059026 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term