WormMine: Gene WBGene00026943

• WormBase Gene ID: WBGene00026943
• Gene Name: Cbr-dnc-5
• Sequence Name: CBG04225
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Trimeric LpxA-like superfamily; Hexapeptide repeat; and Bacterial transferase hexapeptide (six repeats). Is an ortholog of C. elegans dnc-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04225a.1	CBG04225a.1		[unknown]
Transcript:CBG04225b.1	CBG04225b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04225b	CBG04225b		[unknown]
CDS:CBG04225a	CBG04225a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065130
• Remark: CBG04225, GATTGCATAGTGAATGCAGCTCAAATCTTTGCATTTGTTCATCTTGGAGCTCGTGCTGTC, WBGene00026943
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term