WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035337 Gene Name  Cbr-edc-4
Sequence Name  ? CBG14967 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; Enhancer of mRNA-decapping protein 4, WD40 repeat region; WD40 region of Ge1, enhancer of mRNA-decapping protein; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans edc-4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG14967c.1 CBG14967c.1   [unknown]
Transcript:CBG14967b.1 CBG14967b.1   [unknown]
Transcript:CBG14967a.1 CBG14967a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG14967b CBG14967b   [unknown]
CDS:CBG14967a CBG14967a   [unknown]
CDS:CBG14967c CBG14967c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG14967, CCACAAAGTTGCATTGTATGAATGTCAGGGCTGGAAATGCCTTGGGCGAATTAGTTTTGA, WBGene00035337   Expr1064135 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term