WormMine: Gene WBGene00122972

• WormBase Gene ID: WBGene00122972
• Gene Name: CJA03768
• Sequence Name: CJA03768
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Surfeit locus protein 6; Surfeit locus 6; and Ribosomal RNA-processing protein 14/surfeit locus protein 6, C-terminal domain.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03768a.1	CJA03768a.1		[unknown]
Transcript:CJA03768b.1	CJA03768b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03768a	CJA03768a		[unknown]
CDS:CJA03768b	CJA03768b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074732
• Remark: CJA04001, CCAAAGTGGAAGAGACGAAAGCGACGATCGCAAAGGTCCGTGAAGCGGATCCGCACAAAG, WBGene00123205
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term