WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134309 Gene Name  Cjp-lem-2
Sequence Name  ? CJA15105 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: LEM/LEM-like domain superfamily; Man1/Src1, C-terminal; MAN1, winged-helix domain; LEM domain; Man1-Src1p-C-terminal domain; and Inner nuclear membrane protein Man1. Is an ortholog of C. elegans lem-2. In C. elegans, lem-2 is involved in several processes, including microtubule organizing center organization; nuclear membrane reassembly; and response to X-ray. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15105.1 CJA15105.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15105 CJA15105   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-lem-2, GATATTGGGCGGCACTGAAAGCAGCTGGAAGAGACTCGCTCAACTTTTTCTACAATTATG, WBGene00134309   Expr1081429 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term