WormMine: Gene WBGene00184445

• WormBase Gene ID: WBGene00184445
• Gene Name: CJA28871
• Sequence Name: CJA28871
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; DNA2/NAM7 helicase-like, C-terminal; and AAA domain. Is an ortholog of C. elegans znfx-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA28871a.1	CJA28871a.1		[unknown]
Transcript:CJA28871b.1	CJA28871b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA28871b	CJA28871b		[unknown]
CDS:CJA28871a	CJA28871a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091239
• Remark: CJA28871, TTCACTCAAAAACAGTCGCACCGATGTGACAGACGCTGACGTTAAAATCATCGTCAGTGC, WBGene00184445
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term