WormMine: Gene WBGene00032126

• WormBase Gene ID: WBGene00032126
• Gene Name: CBG10865
• Sequence Name: CBG10865
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Dolichyl-phosphate-mannose-protein mannosyltransferase; Tetratricopeptide repeat; Tetratricopeptide-like helical domain superfamily; Protein O-mannosyl-transferase TMTC, DUF1736; Glycosyltransferase RgtA/B/C/D-like; and TPR repeat. Is an ortholog of C. elegans F38B6.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10865.1	CBG10865.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10865	CBG10865		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064185
• Remark: CBG10865, CAGCGAACTCTCTTTATACAGCTCTGGGCTCCAAGTATGCCCAATGAATGCGAAAATTCA, WBGene00032126
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term