WormMine: Gene WBGene00026343

• WormBase Gene ID: WBGene00026343
• Gene Name: Cbr-pis-1
• Sequence Name: CBG03482
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: BRCA1 C Terminus (BRCT) domain; BRCT domain; and BRCT domain superfamily. Is an ortholog of C. elegans pis-1. In C. elegans, pis-1 is involved in programmed cell death.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03482.1	CBG03482.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03482	CBG03482		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060657
• Remark: Cbr-pis-1, AGAACATCCGTTTATCATTATTTCCTGTCACAATGATGCTCGATTTTTGAGTTATTTAGG, WBGene00026343
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term